View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2620_low_22 (Length: 228)
Name: NF2620_low_22
Description: NF2620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2620_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 38255815 - 38255655
Alignment:
| Q |
14 |
atatcacaaaataaaggaccgaaaaaataatctattctcaaagattatccctctcaaatttgcaatgtttctatacttagtattaattcttcttaatata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
38255815 |
atatcacaaaataaaggaccgaaaaaataatctattctcaaagattatccctctcaaatttgcaatgtt-ctatacttagtatt-------cttaatata |
38255724 |
T |
|
| Q |
114 |
tagtaacaatcccacatagtcctgggtttacataaacatgatgaattgaaatttcacttgtgattatca |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38255723 |
tagtaacaatcccacatagtcctgggtttacataaacatgatgaattgaaatttcacttgtgattatca |
38255655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University