View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2621_high_14 (Length: 389)
Name: NF2621_high_14
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2621_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 11 - 371
Target Start/End: Complemental strand, 2731324 - 2730964
Alignment:
| Q |
11 |
gagaagcaaaggggaaaaggggtccatatgggttttttaaaaggcgagaaatgcacacccgacaaggaggaaagggtatgtgcataatcttgatcaggtt |
110 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2731324 |
gagaaacaaaggagaaaaggggcccatatgggttttttaaaaggcgagaaatgcacacccgacaaggaggaaaggttatgtgaataatcttgatcaggtt |
2731225 |
T |
|
| Q |
111 |
accatccccttcttcttcagtaacttctaggatgaggtaaaaatgataagagttatggaaactttttgctaaatatgggaggtggggaaagtctatatta |
210 |
Q |
| |
|
||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2731224 |
accatccccttcttcttcactaacttttaagatgaggtaaaaatgataagagttatggaaactttttgctaaatatgggaggtggggaaagtctatattc |
2731125 |
T |
|
| Q |
211 |
ctcaaaagagggatcaatgagggagaaaatatgactttgtgatgtttaaggaggtgaacaatgaagaggagcttgaaaagaggctgggggatgtttggtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2731124 |
ctcaaaagagggatcaatgagggagaaaatatgattttgtgatgtttaaggaggtgaacaatgaagaggagcttgaaaagaggctgggggatgtttggtt |
2731025 |
T |
|
| Q |
311 |
cgatgggaggaagccgaagatcaatagggcacgttttgaaagggttgagaaagtgcaaatt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2731024 |
cgatgggaggaagccgaagatcaatagggcacgttttgaaagggttgagaaactgcaaatt |
2730964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University