View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2621_high_17 (Length: 336)
Name: NF2621_high_17
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2621_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 39641949 - 39641630
Alignment:
| Q |
1 |
tttcggtcttagtgattttccttctcagtcttttgattatggatattttctatatcaatgggcttttgcaattgctgcagcaggaatcactagtggttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39641949 |
tttcggtcttagtgattttccttctcagtcttttgattatggatattttctatatcaatgggcttttgcaattgcttcagcaggaatcactagtggttca |
39641850 |
T |
 |
| Q |
101 |
attgctgagagaacacaatttgtttcttatttgatttattcttcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39641849 |
attgctgagagaacacaatttgtttcttatttgatttattcgtcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatg |
39641750 |
T |
 |
| Q |
201 |
gttggggtagtccggttcggtctgaaaatcttttgtttggttccggtgttattgattttgctggttgtggtgtagttcatttagttggtgcagttgctgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39641749 |
gttggggtagtccggttcggtctgaaaatcttttgtttggttccggtgttattgattttgctggttgtggtgtcgttcatttagttggtgcagttgctgg |
39641650 |
T |
 |
| Q |
301 |
tttttggggtgctttgattg |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39641649 |
tttttggggtgctttgattg |
39641630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 5 - 320
Target Start/End: Complemental strand, 46670142 - 46669827
Alignment:
| Q |
5 |
ggtcttagtgattttccttctcagtcttttgattatggatattttctatatcaatgggcttttgcaattgctgcagcaggaatcactagtggttcaattg |
104 |
Q |
| |
|
||||||| |||||| ||||| || ||||||||||| || | ||| || | ||||||||||||||| |||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
46670142 |
ggtcttactgatttcccttcacaatcttttgattacggttttttcctctttcaatgggcttttgccattgctgcagcagggatcacaagtggatcaattg |
46670043 |
T |
 |
| Q |
105 |
ctgagagaacacaatttgtttcttatttgatttattcttcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatggttg |
204 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| || ||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46670042 |
ctgagagaacacagttcgtttcttatttgatttattcgtcgtttttaaccggtttagtttatccaattgttgctcattggttttggtctgctgatggttg |
46669943 |
T |
 |
| Q |
205 |
gggtagtccggttcggtctgaaaatcttttgtttggttccggtgttattgattttgctggttgtggtgtagttcatttagttggtgcagttgctggtttt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46669942 |
gggtagtccggttcggtctgaaaatcttttgtttggttctggtgttattgattttgctggttgtggtgttgttcatttagttggtgcagttgctggtttt |
46669843 |
T |
 |
| Q |
305 |
tggggtgctttgattg |
320 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
46669842 |
tggggtgcttttattg |
46669827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 101 - 206
Target Start/End: Complemental strand, 35416120 - 35416015
Alignment:
| Q |
101 |
attgctgagagaacacaatttgtttcttatttgatttattcttcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatg |
200 |
Q |
| |
|
||||| |||||||| |||||||| | ||| | || ||||||||||| |||| ||||| |||||||| || ||| | |||||| ||||||| ||||||| |
|
|
| T |
35416120 |
attgcagagagaactcaatttgtcgcctatctcatatattcttctttcttaaccggttttgtttatcccatcgtttcgcattgggtttggtccgctgatg |
35416021 |
T |
 |
| Q |
201 |
gttggg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
35416020 |
gttggg |
35416015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University