View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2621_high_27 (Length: 271)
Name: NF2621_high_27
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2621_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 255
Target Start/End: Complemental strand, 53701275 - 53701034
Alignment:
| Q |
14 |
gatcagaaaccttatgaagaaaaaatattggtgattatggctggacaagataaaccaacattcttagccacaccaagcatgtcttcaagcacaagtacta |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53701275 |
gatcagaaaccgtatgaagaaaaaatattggtgattatggctggacaagataaaccaacattcttagccacaccaagcatgtcttcaagcacaagtacaa |
53701176 |
T |
 |
| Q |
114 |
gtactagtagatcctcttcttttggtgacaacactagtacttgtacttgtgaccatgacaaggaccagaaatcgatggaaaatatgaatgatgaagaatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53701175 |
gtactagtagatcctcttcttttggtgacaacactagtacttgtacttgtgaacatgacaaggaccagaaatcgatagaaaatatgaatgatgaagaatc |
53701076 |
T |
 |
| Q |
214 |
aaccgtgaaacaaggaagcggtggtggtgaaaatcatgtaag |
255 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
53701075 |
aaccgtgaaacaaggagggggtggtggtgaaaatcatgtaag |
53701034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University