View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2621_low_24 (Length: 294)
Name: NF2621_low_24
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2621_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 5612525 - 5612381
Alignment:
| Q |
1 |
aaagtatgtcaatatgtcaattaaaaataccatgaaaaatttcagtgtgtttagtatggttatgaacttatgattaatcatgacataagacatactatac |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5612525 |
aaagtatgtcaatatgacaattaaaaataccatgaaaaatttcagtgtgtttagtatggttatgaacttatgattaatcatgacataagacatactatac |
5612426 |
T |
 |
| Q |
101 |
cataatgctcctccaatgttttcctatatcatcaggttgcaagta |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5612425 |
cataatgctcctccaatgttttcctatataatcaggttgcaagta |
5612381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 5612316 - 5612278
Alignment:
| Q |
210 |
caaattatgatggcaataggcactcatttggcttccttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5612316 |
caaattatgatggcaataggcactcatttggcttccttc |
5612278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University