View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2621_low_28 (Length: 271)

Name: NF2621_low_28
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2621_low_28
NF2621_low_28
[»] chr4 (1 HSPs)
chr4 (14-255)||(53701034-53701275)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 255
Target Start/End: Complemental strand, 53701275 - 53701034
Alignment:
14 gatcagaaaccttatgaagaaaaaatattggtgattatggctggacaagataaaccaacattcttagccacaccaagcatgtcttcaagcacaagtacta 113  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
53701275 gatcagaaaccgtatgaagaaaaaatattggtgattatggctggacaagataaaccaacattcttagccacaccaagcatgtcttcaagcacaagtacaa 53701176  T
114 gtactagtagatcctcttcttttggtgacaacactagtacttgtacttgtgaccatgacaaggaccagaaatcgatggaaaatatgaatgatgaagaatc 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
53701175 gtactagtagatcctcttcttttggtgacaacactagtacttgtacttgtgaacatgacaaggaccagaaatcgatagaaaatatgaatgatgaagaatc 53701076  T
214 aaccgtgaaacaaggaagcggtggtggtgaaaatcatgtaag 255  Q
    |||||||||||||||| | |||||||||||||||||||||||    
53701075 aaccgtgaaacaaggagggggtggtggtgaaaatcatgtaag 53701034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University