View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2621_low_29 (Length: 252)
Name: NF2621_low_29
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2621_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 33 - 239
Target Start/End: Complemental strand, 1877668 - 1877463
Alignment:
| Q |
33 |
tcttttcacattgtcgcactcccaatttttcgatttcaaaactcaaaaatgaaggattttttaacgtgttttgtgcttttcaaattaaataattgaaaat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1877668 |
tcttttcacattgtcgcactcccaatttttcgattttaaaactcaaaaatgaaagattttttaacgtgtttcgtgcttttcaaattaaataattgaaaat |
1877569 |
T |
 |
| Q |
133 |
ctcgtaagatatacgagaaacaagtagaattgnnnnnnnnnntcttgtataacaacagtgaaaatgacaacttcactgccacgataatttagatttagca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1877568 |
ctcgtaagatatacgagaaacaagtagaatag-aaaaaaaaatcttgtataacaacggtgaaaatgacaacttcactgccacgataatttagatttagca |
1877470 |
T |
 |
| Q |
233 |
tcttcaa |
239 |
Q |
| |
|
||||||| |
|
|
| T |
1877469 |
tcttcaa |
1877463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University