View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2621_low_29 (Length: 252)

Name: NF2621_low_29
Description: NF2621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2621_low_29
NF2621_low_29
[»] chr6 (1 HSPs)
chr6 (33-239)||(1877463-1877668)


Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 33 - 239
Target Start/End: Complemental strand, 1877668 - 1877463
Alignment:
33 tcttttcacattgtcgcactcccaatttttcgatttcaaaactcaaaaatgaaggattttttaacgtgttttgtgcttttcaaattaaataattgaaaat 132  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
1877668 tcttttcacattgtcgcactcccaatttttcgattttaaaactcaaaaatgaaagattttttaacgtgtttcgtgcttttcaaattaaataattgaaaat 1877569  T
133 ctcgtaagatatacgagaaacaagtagaattgnnnnnnnnnntcttgtataacaacagtgaaaatgacaacttcactgccacgataatttagatttagca 232  Q
    |||||||||||||||||||||||||||||| |          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
1877568 ctcgtaagatatacgagaaacaagtagaatag-aaaaaaaaatcttgtataacaacggtgaaaatgacaacttcactgccacgataatttagatttagca 1877470  T
233 tcttcaa 239  Q
    |||||||    
1877469 tcttcaa 1877463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University