View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_110 (Length: 233)
Name: NF2622_high_110
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 41822759 - 41822642
Alignment:
| Q |
15 |
gatataaagatgaactcgaggaagctattgtctcatgcttttgtgttggattatgatgaagcaggacccaacccaaagcattcaaagaaacctggcaagg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41822759 |
gatataaagatgaactcgaggaagctattgtctcatgcttttgtgttggattatgatgaagcaggacccaacccaaagcattcaaagaaacctggcaagg |
41822660 |
T |
 |
| Q |
115 |
gtcgttaaacaccttaac |
132 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41822659 |
gtcgttaaacaccttaac |
41822642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University