View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_high_110 (Length: 233)

Name: NF2622_high_110
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_high_110
NF2622_high_110
[»] chr3 (1 HSPs)
chr3 (15-132)||(41822642-41822759)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 41822759 - 41822642
Alignment:
15 gatataaagatgaactcgaggaagctattgtctcatgcttttgtgttggattatgatgaagcaggacccaacccaaagcattcaaagaaacctggcaagg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41822759 gatataaagatgaactcgaggaagctattgtctcatgcttttgtgttggattatgatgaagcaggacccaacccaaagcattcaaagaaacctggcaagg 41822660  T
115 gtcgttaaacaccttaac 132  Q
    ||||||||||||||||||    
41822659 gtcgttaaacaccttaac 41822642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University