View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_114 (Length: 229)
Name: NF2622_high_114
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_114 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 4212692 - 4212472
Alignment:
| Q |
3 |
cgaatgcgaatgcgaatgcagaaacaaataataccaaactttatatatttatattaatttgatatgatatttaatatttgaaagagacgggtagatggga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4212692 |
cgaatgcgaatgcgaatgcagaaacaaataataccaaactttatatatttatattaatttgatatgatatttaatatttgaaagagacgggtagat---- |
4212597 |
T |
 |
| Q |
103 |
atgggaggataatttcgaagaaagttctggttattaatgttaaattactggaatatccctttcttacttaccaa-------gtaatagtaatccaaattt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4212596 |
--gggaggataatttcgaagaaagttctggttattaatgtt-aattactagaatgtccctttcttacttaccaagtaatatgtaatagtaatccaaattt |
4212500 |
T |
 |
| Q |
196 |
ggctttgtcttgttttcattcttctcac |
223 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
4212499 |
ggctttgtcttgttttcattcatctcac |
4212472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University