View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_high_22 (Length: 472)

Name: NF2622_high_22
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_high_22
NF2622_high_22
[»] chr6 (1 HSPs)
chr6 (18-213)||(33721131-33721326)
[»] scaffold0272 (1 HSPs)
scaffold0272 (222-418)||(7263-7462)
[»] chr8 (1 HSPs)
chr8 (83-207)||(24944790-24944914)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 7e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 33721131 - 33721326
Alignment:
18 aattatgataggaatcattgttttgggagtttttatacgacaaaaatcggagcatgaatgtataaaatcggagcacaattttgtggataacggtcaattc 117  Q
    |||||||||||||||||||| | |||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||    
33721131 aattatgataggaatcattgctgtgggagtttttataagacaaaaatcggggcatgaatgtataaaatcggagcacaatcttgtggataacggtcaattc 33721230  T
118 ctgctgtgtacgaactgcaaattggggcacgaaatttctcaggacatgaccactattcaaggcttcgttcttcatgttttgaggtgacttccattc 213  Q
    || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33721231 ctactgtgtacgaactgcaaatcggggcacgaaatttctcaggacatgaccactattcaaggcttcgttcttcatgttttgaggtgacttccattc 33721326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0272 (Bit Score: 133; Significance: 6e-69; HSPs: 1)
Name: scaffold0272
Description:

Target: scaffold0272; HSP #1
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 222 - 418
Target Start/End: Complemental strand, 7462 - 7263
Alignment:
222 tggcattggattcacttatgtctttgatcttt--ctttctttcaaatatgttgtttatctctttctttttccaaagcaccaggaccttacagtccaattt 319  Q
    ||||||||||||||||| |||||||||| |||  |||||||| |||| | |||||||||||||||||||||||||||||||| |||| ||||||||||||    
7462 tggcattggattcacttgtgtctttgatatttttctttcttttaaatcttttgtttatctctttctttttccaaagcaccagaacctaacagtccaattt 7363  T
320 tgagaccaactcctattagtg-cagttcactagtaacaattacataagaacactcaataaatgtcctcaaaccgatgggcaaagtgaggtcctcaataaa 418  Q
    | ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
7362 ttagaccaattcctattagtgtcagttcactagtaacaattgcataagaacactcaataaatgtcctcaaacctatgggaaaagtgaggtcctcaataaa 7263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 83 - 207
Target Start/End: Original strand, 24944790 - 24944914
Alignment:
83 aatcggagcacaattttgtggataacggtcaattcctgctgtgtacgaactgcaaattggggcacgaaatttctcaggacatgaccactattcaaggctt 182  Q
    ||||||||||| ||||||||||||| ||||||||| | |||||||| |||  ||  | ||||||| |||||| || ||| || | || ||||||||||||    
24944790 aatcggagcacgattttgtggataaaggtcaattcgtactgtgtacaaacaacagttcggggcacaaaatttttcgggatataagcattattcaaggctt 24944889  T
183 cgttcttcatgttttgaggtgactt 207  Q
    || |||||||||| |||||||||||    
24944890 cgctcttcatgttgtgaggtgactt 24944914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University