View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_63 (Length: 289)
Name: NF2622_high_63
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 6026690 - 6026412
Alignment:
| Q |
1 |
ggtgaagatggtaatggaattgttgatatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaagctccatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6026690 |
ggtgaagatggtaatggaattgttgaaatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaggctccatc |
6026591 |
T |
 |
| Q |
101 |
ttttttagccactttgattaatgtcagacatattctctccaacggtccaccacatccaataaaatatcgacggttgaatcatgattgtatctcgatttaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
6026590 |
ttttttagcaactttgattaatgtcagacatattctctgcaacggtccaccacatccaataaaatttcgaaggttgaatcatgattgtatctcgatttaa |
6026491 |
T |
 |
| Q |
201 |
tcgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttggtttgtgcattcagttcat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6026490 |
ccgttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttgttttgtgcattcagttcat |
6026412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University