View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_69 (Length: 278)
Name: NF2622_high_69
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_69 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 55162529 - 55162252
Alignment:
| Q |
1 |
tatattgtgccctctagctatgattttgttggctctaacaaattgcatcatttgatctgaaattgtgtagttgactctgccttcatgaggctctgtggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55162529 |
tatattgtgccctctagctatgattttgttggctctaacaaattgcatcatttggtctgaaattgtgtagttgacgctgccttcatgaggctctgtggca |
55162430 |
T |
 |
| Q |
101 |
taccatttaagctcgttttcaaacactgcagcattgaaccgtttcaaaaaccaattctgatatggtatgttgccaagaatggtctttgatatcgcagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55162429 |
taccatttaagctcgttttcaaacactgcagcattgaaccgtttcaaaaaccaattctgatatggtatgttgccaagaatggtctttgctatcgcagagc |
55162330 |
T |
 |
| Q |
201 |
caataggaaagtcttttgatatttgctctacaaacacagaagctccttgtaatttctttccattagggtctgatacat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55162329 |
caataggaaagtcttttgatatttgctctacaaacacagaagctccttgtaatttccttccattagggtctgatacat |
55162252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University