View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_70 (Length: 271)
Name: NF2622_high_70
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 50975196 - 50974955
Alignment:
| Q |
11 |
cacagaataatggaggatttcaatgttttgagtgttctttcattttagttcccttcaaattcctctgctgcttgtgtccacaaggaatagggaaaagatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50975196 |
cacagaataatggaggatttcaatgttttgagtgttctttcattttagttcccttcaaattcctctgctgcttgtgtccacaaggaatagggaaaagatg |
50975097 |
T |
|
| Q |
111 |
cttgttttggggaatgctcccctcaaatttcagatcctctcctctgatcatatagacattccctgcttccggaacggtgaattcagcagggtttctattc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50975096 |
cttgttttggggaatgctcccctcaaatttcagatcctctcctctgatcatatagacattccctgcttccggaacggtgaattcagcagggtttctattc |
50974997 |
T |
|
| Q |
211 |
accgtacatgagatgccagatgtggtctttaacggcacagag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50974996 |
accgtacatgagatgccagatgtggtctttaacggcacagag |
50974955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 51078328 - 51078087
Alignment:
| Q |
11 |
cacagaataatggaggatttcaatgttttgagtgttctttcattttagttcccttcaaattcctctgctgcttgtgtccacaaggaatagggaaaagatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51078328 |
cacagaataatggaggatttcaatgttttgagtgttctttcattttagttcccttcaaattcctctgctgcttgtgtccacaaggaatagggaaaagatg |
51078229 |
T |
|
| Q |
111 |
cttgttttggggaatgctcccctcaaatttcagatcctctcctctgatcatatagacattccctgcttccggaacggtgaattcagcagggtttctattc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51078228 |
cttgttttggggaatgctcccctcaaatttcagatcctctcctctgatcatatagacattccctgcttccggaacggtgaattcagcagggtttctattc |
51078129 |
T |
|
| Q |
211 |
accgtacatgagatgccagatgtggtctttaacggcacagag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51078128 |
accgtacatgagatgccagatgtggtctttaacggcacagag |
51078087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University