View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_high_73 (Length: 266)
Name: NF2622_high_73
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_high_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 19198680 - 19198434
Alignment:
| Q |
1 |
gagaagaaaaagggccagagttggttacaaaaacagctttcaagtaaaacaggtcgtgattgcgactacatagatatggtgcatggtgcagcagtagctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198680 |
gagaagaaaaagggccagagttggttacaaaaacagctttcaagtaaaacaggtcgtgattgcgactacatagatatggtgcatggtgcagcagtagctg |
19198581 |
T |
|
| Q |
101 |
ctgctgcattctcaattaatttgcaagagacctctgagcagaagagtgagaccccggaggcctcattggccaaggtcaaaagcaaggtagacagctcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198580 |
ctgctgcattctcaattaatttgcaatagacctctgagcagaagagtgagaccccggaggcctcattggccaaggtcaaaagcaaggtagacagctcaaa |
19198481 |
T |
|
| Q |
201 |
atcttcaaagtcccttctcagtagtatatccaagcgattatcaggta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198480 |
atcttcaaagtcccttctcagtagtatatccaagcgattatcaggta |
19198434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 19202751 - 19202505
Alignment:
| Q |
1 |
gagaagaaaaagggccagagttggttacaaaaacagctttcaagtaaaacaggtcgtgattgcgactacatagatatggtgcatggtgcagcagtagctg |
100 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
19202751 |
gagaagaagaagggccagaattggttgcaaaaacagctttcaagtaaaacaggccgtgattacgactacatagaaatggtgcatgctgcagcagtagctg |
19202652 |
T |
|
| Q |
101 |
ctgctgcattctcaattaatttgcaagagacctctgagcagaagagtgagaccccggaggcctcattggccaaggtcaaaagcaaggtagacagctcaaa |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |||| |
|
|
| T |
19202651 |
ctgctgcattatcaattaatttgcaagagacatttgagcagaagagtgagaccccggaggcctcatcggccaaggtcaaaagcaacatggacagcacaaa |
19202552 |
T |
|
| Q |
201 |
atcttcaaagtcccttctcagtagtatatccaagcgattatcaggta |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19202551 |
atcttcaaagtcccttctcagtagtgcatccaagcgattatcaggta |
19202505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University