View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_high_89 (Length: 246)

Name: NF2622_high_89
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_high_89
NF2622_high_89
[»] chr7 (1 HSPs)
chr7 (1-106)||(38744044-38744149)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 38744149 - 38744044
Alignment:
1 tgttgctttcaatggaaatagacacacctaagcttgtgttttgtccatggagaaattaaaggtagcgataattgcttcgatggaatggaaacccagacaa 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38744149 tgttgctttcaatggaaatagacacacctaagcttgtgttgtgtccatggagaaattaaaggtagcgataattgcttcgatggaatggaaacccagacaa 38744050  T
101 catgag 106  Q
    ||||||    
38744049 catgag 38744044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University