View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_111 (Length: 235)
Name: NF2622_low_111
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_111 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 47582880 - 47583086
Alignment:
| Q |
14 |
cctaagtcgcacgttaagaagagttaaggggtaaagaagcttagaagtgtgcgaggatgtgttaaacttaatatagaaaacttatatgctaacagagttt |
113 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582880 |
cctaagtcgcacgatcagaagagttaaggggtaaagaagcttagaagtgtgcgaggatgtgttaaacttaatatagaaaacttatatgctaacagagttt |
47582979 |
T |
 |
| Q |
114 |
attcatcaaggctcttggagcggatgtcatgtcatggctctgataacatgttaatgctgaaaatctgaatgaaagattagttttgtctatgctcaaagga |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582980 |
attcatcaaggctcttcgagcggatgtcatgtcatggctctgataacatgttaatgctgaaaatctgaatgaaagattagttttgtctatgctcaaagga |
47583079 |
T |
 |
| Q |
214 |
gtgaaat |
220 |
Q |
| |
|
||||||| |
|
|
| T |
47583080 |
gtgaaat |
47583086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University