View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_117 (Length: 229)
Name: NF2622_low_117
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_117 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 9 - 211
Target Start/End: Original strand, 3725260 - 3725461
Alignment:
| Q |
9 |
gtgagatgaacaaaagtttgtggtatatgaagnnnnnnnnctttcattcaattaagctcataataatgtatttattcacttgaaaacttcatgattaata |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3725260 |
gtgagatgaacaaaagtttgtggtatatgaa-aaaaaaaactttcattcaattaagctcataataatgtatttattcacttgaaaacttcatgattaata |
3725358 |
T |
 |
| Q |
109 |
tccacatttttacgaatctttctaattatgttcaataatttgaagggaagcgaaaatccttgtgtccttgctcatttgctcattttaaacaaacaattct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3725359 |
tccacatttttacgaatctttctaattatgttcaataatttgaagggaagcgaaaatccttgtgtccttgctcatttgctcattttaaacaaacaattct |
3725458 |
T |
 |
| Q |
209 |
aat |
211 |
Q |
| |
|
||| |
|
|
| T |
3725459 |
aat |
3725461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University