View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_119 (Length: 225)
Name: NF2622_low_119
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_119 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 209
Target Start/End: Original strand, 38043377 - 38043507
Alignment:
| Q |
79 |
cacattatccattttaaaatggaaaatgcaataaaaactggcgcaataaaccaaaatatccattttaaaggaatcaattttgggttttatgcactattaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38043377 |
cacattatccattttaaaatggaaaatgcaataaaaactggcgcaataaaccataatatccattttaaaggaatcaattttgggttttatgcactattaa |
38043476 |
T |
 |
| Q |
179 |
taaacgatttctatgtcttcatgaacttaat |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
38043477 |
taaacgatttctatgtcttcgtgaacttaat |
38043507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University