View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_low_119 (Length: 225)

Name: NF2622_low_119
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_low_119
NF2622_low_119
[»] chr5 (1 HSPs)
chr5 (79-209)||(38043377-38043507)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 209
Target Start/End: Original strand, 38043377 - 38043507
Alignment:
79 cacattatccattttaaaatggaaaatgcaataaaaactggcgcaataaaccaaaatatccattttaaaggaatcaattttgggttttatgcactattaa 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38043377 cacattatccattttaaaatggaaaatgcaataaaaactggcgcaataaaccataatatccattttaaaggaatcaattttgggttttatgcactattaa 38043476  T
179 taaacgatttctatgtcttcatgaacttaat 209  Q
    |||||||||||||||||||| ||||||||||    
38043477 taaacgatttctatgtcttcgtgaacttaat 38043507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University