View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_123 (Length: 215)
Name: NF2622_low_123
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_123 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 40641423 - 40641230
Alignment:
| Q |
1 |
atacttcaaccaaaaataattactaagaaaataaaatgcaagactgccnnnnnnnnnnnnnngagaatacttcaaccaacatgtcatgattccacacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40641423 |
atacttcaaccaaaaataattactaagaaattaaaatgcaagactgccaaaaaaaatga---gagaatacttcaaccaacatgtcatgattccacacctt |
40641327 |
T |
|
| Q |
101 |
gaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctccgtctccac |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
40641326 |
gaacctccgttgtaccacccagtggacagcgccactactctttctgagtagctatggaactgttcgtcgcactgtgatggagctccttcgtctccac |
40641230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 90 - 197
Target Start/End: Original strand, 40627866 - 40627973
Alignment:
| Q |
90 |
ttccacaccttgaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctcc |
189 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| ||||| |||||||| |||||| ||| | | ||| ||||| ||||| ||| ||||||| |
|
|
| T |
40627866 |
ttccacatcttgaacctccgttgtaccacccagtggacaaagccaccactctttccgagttgtcgtggtatttttcatcgcattgagacggacctcctcc |
40627965 |
T |
|
| Q |
190 |
gtctccac |
197 |
Q |
| |
|
|||||||| |
|
|
| T |
40627966 |
gtctccac |
40627973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 40617155 - 40617260
Alignment:
| Q |
90 |
ttccacaccttgaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctcc |
189 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| || | ||||| | |||||| |||||||||||||| || ||||||||||| | | ||||||| |
|
|
| T |
40617155 |
ttccacaccttgaacctccactgtaccatccagtcgataatgccacgattctttccgagttgctatggaatatctcatcgcactgagaagcacctcctcc |
40617254 |
T |
|
| Q |
190 |
gtctcc |
195 |
Q |
| |
|
|||||| |
|
|
| T |
40617255 |
gtctcc |
40617260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University