View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_low_123 (Length: 215)

Name: NF2622_low_123
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_low_123
NF2622_low_123
[»] chr2 (3 HSPs)
chr2 (1-197)||(40641230-40641423)
chr2 (90-197)||(40627866-40627973)
chr2 (90-195)||(40617155-40617260)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 40641423 - 40641230
Alignment:
1 atacttcaaccaaaaataattactaagaaaataaaatgcaagactgccnnnnnnnnnnnnnngagaatacttcaaccaacatgtcatgattccacacctt 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||              ||||||||||||||||||||||||||||||||||||||    
40641423 atacttcaaccaaaaataattactaagaaattaaaatgcaagactgccaaaaaaaatga---gagaatacttcaaccaacatgtcatgattccacacctt 40641327  T
101 gaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctccgtctccac 197  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||    
40641326 gaacctccgttgtaccacccagtggacagcgccactactctttctgagtagctatggaactgttcgtcgcactgtgatggagctccttcgtctccac 40641230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 90 - 197
Target Start/End: Original strand, 40627866 - 40627973
Alignment:
90 ttccacaccttgaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctcc 189  Q
    ||||||| |||||||||||| ||||||||||||||||||  ||||| |||||||| ||||||   ||| | | ||| ||||| ||||| ||| |||||||    
40627866 ttccacatcttgaacctccgttgtaccacccagtggacaaagccaccactctttccgagttgtcgtggtatttttcatcgcattgagacggacctcctcc 40627965  T
190 gtctccac 197  Q
    ||||||||    
40627966 gtctccac 40627973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 40617155 - 40617260
Alignment:
90 ttccacaccttgaacctccgctgtaccacccagtggacagcgccactactctttctgagttgctatggaactgttcgtcgcactgagatggagctcctcc 189  Q
    ||||||||||||||||||| |||||||| ||||| || |  ||||| | |||||| ||||||||||||||    || ||||||||||| | | |||||||    
40617155 ttccacaccttgaacctccactgtaccatccagtcgataatgccacgattctttccgagttgctatggaatatctcatcgcactgagaagcacctcctcc 40617254  T
190 gtctcc 195  Q
    ||||||    
40617255 gtctcc 40617260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University