View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_21 (Length: 476)
Name: NF2622_low_21
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 414; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 10 - 462
Target Start/End: Complemental strand, 311687 - 311232
Alignment:
| Q |
10 |
gagaagaagaagaaatggcgtcaatggcagcagcagca---acgatgggtttaggtttgggtatggggggtatgactgtaacttcccatttctcaccttc |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
311687 |
gagaacaagaagaaatggcgtcaatggcagcagcagcagcaacgatgggtttaggtttgggtatggggggtatgactgtaacttcccatttctcaccttc |
311588 |
T |
 |
| Q |
107 |
gtctcgtcttctctctttccaacctaataatctaatcatccctcatcacaaacgccgaacaacttgttctatttcaatcaaccacaaaaccaccaccctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
311587 |
atctcgtcttctctctttccaacctaataatctaatcaaccctcaacacaaacgccgaacaacatgttctatttcaatcaaccacaaaaccaacaccctc |
311488 |
T |
 |
| Q |
207 |
atcaacaatgaaagcaacaacgttcttctctctggttccactcgaacagttacaaccctattcgccaccgcgcttttatgtgtcaaagcattcgtcaaca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
311487 |
atcaacaatgaaagcaacaacgttcttctctctggttccactcgaacagttacaaccctattcgccaccgcgcttttatgtgtcaaagcattcgtcaaca |
311388 |
T |
 |
| Q |
307 |
ttcttccaccaccagacctatgtgcatcaattgcaacatcatcagcgtcgctttgtttcgctgtcatgaaaaataccaggtcggggacggtgaacacgcc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
311387 |
ttcttccaccaccagacctatgtgcatcaattgcaacatcatcagcgtcgctttgtttcgctgtcatgaaaaatactaggtcggggacggtgaacacgcc |
311288 |
T |
 |
| Q |
407 |
gttgacggttgtagcggcggggttgaagaaatggttggatatttacagtggtgtgt |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
311287 |
gttgacggttgtagcggcggggttgaagaaatggttggatatttacagtggtgtgt |
311232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University