View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_23 (Length: 472)
Name: NF2622_low_23
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_23 |
 | |
|
| [»] scaffold0272 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 7e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 33721131 - 33721326
Alignment:
| Q |
18 |
aattatgataggaatcattgttttgggagtttttatacgacaaaaatcggagcatgaatgtataaaatcggagcacaattttgtggataacggtcaattc |
117 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33721131 |
aattatgataggaatcattgctgtgggagtttttataagacaaaaatcggggcatgaatgtataaaatcggagcacaatcttgtggataacggtcaattc |
33721230 |
T |
|
| Q |
118 |
ctgctgtgtacgaactgcaaattggggcacgaaatttctcaggacatgaccactattcaaggcttcgttcttcatgttttgaggtgacttccattc |
213 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33721231 |
ctactgtgtacgaactgcaaatcggggcacgaaatttctcaggacatgaccactattcaaggcttcgttcttcatgttttgaggtgacttccattc |
33721326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 133; Significance: 6e-69; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 222 - 418
Target Start/End: Complemental strand, 7462 - 7263
Alignment:
| Q |
222 |
tggcattggattcacttatgtctttgatcttt--ctttctttcaaatatgttgtttatctctttctttttccaaagcaccaggaccttacagtccaattt |
319 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||||||| |||| | |||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
7462 |
tggcattggattcacttgtgtctttgatatttttctttcttttaaatcttttgtttatctctttctttttccaaagcaccagaacctaacagtccaattt |
7363 |
T |
|
| Q |
320 |
tgagaccaactcctattagtg-cagttcactagtaacaattacataagaacactcaataaatgtcctcaaaccgatgggcaaagtgaggtcctcaataaa |
418 |
Q |
| |
|
| ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7362 |
ttagaccaattcctattagtgtcagttcactagtaacaattgcataagaacactcaataaatgtcctcaaacctatgggaaaagtgaggtcctcaataaa |
7263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 83 - 207
Target Start/End: Original strand, 24944790 - 24944914
Alignment:
| Q |
83 |
aatcggagcacaattttgtggataacggtcaattcctgctgtgtacgaactgcaaattggggcacgaaatttctcaggacatgaccactattcaaggctt |
182 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| | |||||||| ||| || | ||||||| |||||| || ||| || | || |||||||||||| |
|
|
| T |
24944790 |
aatcggagcacgattttgtggataaaggtcaattcgtactgtgtacaaacaacagttcggggcacaaaatttttcgggatataagcattattcaaggctt |
24944889 |
T |
|
| Q |
183 |
cgttcttcatgttttgaggtgactt |
207 |
Q |
| |
|
|| |||||||||| ||||||||||| |
|
|
| T |
24944890 |
cgctcttcatgttgtgaggtgactt |
24944914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University