View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_50 (Length: 335)
Name: NF2622_low_50
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 10455441 - 10455524
Alignment:
| Q |
214 |
gttaattattattttacaaatcatatccttaatttaaattctgtaattaaattttctcaactc-ttttttattactaataaaaa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10455441 |
gttaattattattttacaaatcatatccttaatttaaattctgtaattaaattttctcaacactttttttattactaataaaaa |
10455524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 10455241 - 10455301
Alignment:
| Q |
13 |
aaaatggttggttgaataaatgacttgtccccaataaaaaattaaacatttcacaacttgt |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10455241 |
aaaatggttggttgaataaatgacttgtccccaataaaaaataaaacatttcacaacttgt |
10455301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University