View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_low_50 (Length: 335)

Name: NF2622_low_50
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_low_50
NF2622_low_50
[»] chr5 (2 HSPs)
chr5 (214-296)||(10455441-10455524)
chr5 (13-73)||(10455241-10455301)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 10455441 - 10455524
Alignment:
214 gttaattattattttacaaatcatatccttaatttaaattctgtaattaaattttctcaactc-ttttttattactaataaaaa 296  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
10455441 gttaattattattttacaaatcatatccttaatttaaattctgtaattaaattttctcaacactttttttattactaataaaaa 10455524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 10455241 - 10455301
Alignment:
13 aaaatggttggttgaataaatgacttgtccccaataaaaaattaaacatttcacaacttgt 73  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
10455241 aaaatggttggttgaataaatgacttgtccccaataaaaaataaaacatttcacaacttgt 10455301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University