View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_low_57 (Length: 312)

Name: NF2622_low_57
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_low_57
NF2622_low_57
[»] chr8 (2 HSPs)
chr8 (135-207)||(36885627-36885699)
chr8 (245-297)||(36885738-36885790)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 135 - 207
Target Start/End: Original strand, 36885627 - 36885699
Alignment:
135 tactattatctcaaatcaccatccagagtacaatctacttattttatatgaatcttcaggataatcaactagc 207  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
36885627 tactattatctcaaatcaccatccaaagtacaatctacttattttatatgaatcttcaggataatcaactagc 36885699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 245 - 297
Target Start/End: Original strand, 36885738 - 36885790
Alignment:
245 tgagaagtgttggaaattaccaggaagtcatggtcgatgggtggaggagaaag 297  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36885738 tgagaagtgttggaaattaccaggaagtcatggtcgatgggtggaggagaaag 36885790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University