View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_64 (Length: 291)
Name: NF2622_low_64
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 11 - 277
Target Start/End: Complemental strand, 33042865 - 33042622
Alignment:
| Q |
11 |
cagagatgaccatggtaatatctagtccagggtttctacttaatatcatacctacttctgctcgactgcaatgcaagtcctttcttataagcccctcatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| || | |
|
|
| T |
33042865 |
cagagatgaccatggtaatatctagtccagggtttctacttaatatcatacctacttctgctcaactg-----caagtcctttctta-----ccgt---- |
33042780 |
T |
|
| Q |
111 |
ttcttaccgtaaaattggaatccttcaatctagttgatcaggaatccaataagtgtacatattttgaggcttccattgagtttatcctcttctacatggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042779 |
---------taaaattggaatccttcaatctagttgatcaggaatccaataagtgtacatattttgaggcttccattgagtttatcctcttctacatggt |
33042689 |
T |
|
| Q |
211 |
ttgcttaatgatgatgtctaagaagtttggtttcagaccggttcttgttaaatttttgggtgataaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042688 |
ttgcttaatgatgatgtctaagaagtttggtttcagaccggttcttgttaaatttttgggtgataaa |
33042622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University