View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_77 (Length: 257)
Name: NF2622_low_77
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_77 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 119 - 246
Target Start/End: Original strand, 10253903 - 10254030
Alignment:
| Q |
119 |
aggttttatttaccttttagccgaactctaaattatcatgacccctttctcataaaaattgaaggtacaacacataatataaaataaaatacttcatctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10253903 |
aggttttatttaccttttagccgaactccaaattatcatgacccatttctcataaaaattgaaggtacaacacagaatataaaataaaatacttcctctc |
10254002 |
T |
|
| Q |
219 |
caataaaggtatctgaacctaatttctt |
246 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
10254003 |
caataaagacatctgaacctaatttctt |
10254030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 10253785 - 10253822
Alignment:
| Q |
1 |
caataaccacaaaaaataattcaagtcagcctaatcac |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10253785 |
caataaccacaaaaaataattcaagtcagcctaatcac |
10253822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 162
Target Start/End: Complemental strand, 25481543 - 25481503
Alignment:
| Q |
122 |
ttttatttaccttttagccgaactctaaattatcatgaccc |
162 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
25481543 |
ttttatttatcttttagccgaactttagattatcatgaccc |
25481503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University