View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_80 (Length: 253)
Name: NF2622_low_80
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 234
Target Start/End: Complemental strand, 14551080 - 14550858
Alignment:
| Q |
12 |
atgaagaccttgtaacatgccagtagtagcatgagtacgaaaattgttcccaaaagcaaatgtcccaaccaaaactatactctactatcaagagaataag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14551080 |
atgaagaccttgtaacatgccagtagtagcatgagtacgaaaattgttcccaaaagcaaatgtcccaaccaaaactatactctactatcaagagaataag |
14550981 |
T |
 |
| Q |
112 |
ataggtttcttttccaaagagggaccctataaatcgactagtgttatggttcctccaattgtctaaaggttaatagcagaagctcatagtgaacaataac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14550980 |
ataggtttcttttccaaagagggaccctctaaatcgacaagtgttatggttcctccaattgtctaaaggttaatagcagaagctcatagtgaacaataac |
14550881 |
T |
 |
| Q |
212 |
aaaacaaagcactaggacagggt |
234 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
14550880 |
aaaacaaagcactaagacagggt |
14550858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University