View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_84 (Length: 250)
Name: NF2622_low_84
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 11134757 - 11134964
Alignment:
| Q |
18 |
taacattgctcataaagaattcattcaccatatagtagttggcataggattaaaataatggttcttt-aaatgttttcactcattgttgaaggcaccaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11134757 |
taacattgctcataaagaattcattcacgatatattagttggcttaggattaaaataatggttcttttaaatgttttcattcattgttgaaggcaccaca |
11134856 |
T |
 |
| Q |
117 |
tatgttggagattagattagaaacgaaaataacatatatgtaagaatcaaaaacatgttaaaatagatagatttttgatactat-aaaaaatcttttgat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
11134857 |
tatgttggagattagattagaaacgaaaataacatatctatgagaatcaaaaacatgttaaaatagatagatttttgatactataaaaaaatcttttaat |
11134956 |
T |
 |
| Q |
216 |
acaacgcc |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
11134957 |
acaacgcc |
11134964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University