View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_91 (Length: 246)
Name: NF2622_low_91
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 38744149 - 38744044
Alignment:
| Q |
1 |
tgttgctttcaatggaaatagacacacctaagcttgtgttttgtccatggagaaattaaaggtagcgataattgcttcgatggaatggaaacccagacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38744149 |
tgttgctttcaatggaaatagacacacctaagcttgtgttgtgtccatggagaaattaaaggtagcgataattgcttcgatggaatggaaacccagacaa |
38744050 |
T |
 |
| Q |
101 |
catgag |
106 |
Q |
| |
|
|||||| |
|
|
| T |
38744049 |
catgag |
38744044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University