View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_94 (Length: 244)
Name: NF2622_low_94
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_94 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 36 - 234
Target Start/End: Complemental strand, 11134484 - 11134286
Alignment:
| Q |
36 |
gttatatacatttcatcttgataataattccacaaaccctaccctaccctaaaacaaaaaataacttagaaagaagaagtataatctgcataactataaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11134484 |
gttatatacatttcatcttgataataattccacaaaccctaccctaccctaaaacaaaaaataacttagaaagaagaagtataatctgcataactataaa |
11134385 |
T |
 |
| Q |
136 |
actcactaataccagaagcaacccaaagacgttgattataatcatcaaccatatcatcaggaacaaaacctgttctacaaagtggacatgttttctgat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11134384 |
actcactaataccagaagcaacccaaagacgttgattataatcatcaaccatatcatcaggaacaaaacctgttctacaaagtggacatgttttctgat |
11134286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University