View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2622_low_96 (Length: 242)
Name: NF2622_low_96
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2622_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 8586212 - 8586273
Alignment:
| Q |
1 |
cctcttgttggacctacttcacttgcacaaaattttattacttttattttcaaagttgaatt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8586212 |
cctcttgttggacctacttcacttgcacaaaattttattacttttattttcaaagttgaatt |
8586273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 170 - 230
Target Start/End: Original strand, 8586298 - 8586358
Alignment:
| Q |
170 |
agcgatgttgtaattcaatcatattgtgtcgtgtaacatttaatttattttaatattgcat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8586298 |
agcgatgttgtaattcaatcatattgtgtcgtgtaacatttaatttattttaatattgcat |
8586358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University