View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2622_low_96 (Length: 242)

Name: NF2622_low_96
Description: NF2622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2622_low_96
NF2622_low_96
[»] chr5 (2 HSPs)
chr5 (1-62)||(8586212-8586273)
chr5 (170-230)||(8586298-8586358)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 8586212 - 8586273
Alignment:
1 cctcttgttggacctacttcacttgcacaaaattttattacttttattttcaaagttgaatt 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8586212 cctcttgttggacctacttcacttgcacaaaattttattacttttattttcaaagttgaatt 8586273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 170 - 230
Target Start/End: Original strand, 8586298 - 8586358
Alignment:
170 agcgatgttgtaattcaatcatattgtgtcgtgtaacatttaatttattttaatattgcat 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8586298 agcgatgttgtaattcaatcatattgtgtcgtgtaacatttaatttattttaatattgcat 8586358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University