View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2623-Insertion-7 (Length: 352)
Name: NF2623-Insertion-7
Description: NF2623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2623-Insertion-7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 8e-49; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 233 - 339
Target Start/End: Original strand, 25192170 - 25192276
Alignment:
| Q |
233 |
ataaccttattcttggtttttgattgcattttagagcagtgagattagggagaaattgtgcttgcatggaaaatatcgtctcactttaattgatctatac |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25192170 |
ataaccttattcttggtttttgattgcattttagagcagtgagattagggagaaattgagcttgcatggaaaatatcgtctcactttaattgatctatac |
25192269 |
T |
 |
| Q |
333 |
atccaga |
339 |
Q |
| |
|
|| |||| |
|
|
| T |
25192270 |
atgcaga |
25192276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 13 - 101
Target Start/End: Original strand, 25191946 - 25192038
Alignment:
| Q |
13 |
tacacgacactctccaacgttagtgtagaaccgttcac----tctctcaatcactggccatttcatttctgcagataagaccagcttctcagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25191946 |
tacacgacactctccaacgttagtgtagaaccgttcactcactctctcaatcactggccatttcatttctgcagataagaccagcttctcagg |
25192038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 25192076 - 25192108
Alignment:
| Q |
134 |
atcacttcatattcatctaacatatgatcatgc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25192076 |
atcacttcatattcatctaacatatgatcatgc |
25192108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University