View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2623_low_11 (Length: 202)

Name: NF2623_low_11
Description: NF2623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2623_low_11
NF2623_low_11
[»] chr3 (1 HSPs)
chr3 (14-178)||(25382295-25382458)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 14 - 178
Target Start/End: Complemental strand, 25382458 - 25382295
Alignment:
14 atattgttatgtctaaacaaaaacaaatagtttaaacatgtatacccttgaatgattttaaacatataataatgactcacaatggaaaataaatcatatt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25382458 atattgttatgtctaaacaaaaacaaatagtttaaacatgtatacccttgaatgattttaaacatataataatgactcacaatggaaaataaatcatatt 25382359  T
114 tatgtctttgtcnnnnnnnnnnnntcatatttatgtcaatattcccattaattggcccattatga 178  Q
    ||||||||||||            |||||||||||||||||||||||||||||||||||||||||    
25382358 tatgtctttgtc-aaaaaaaaaaatcatatttatgtcaatattcccattaattggcccattatga 25382295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University