View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2623_low_4 (Length: 379)
Name: NF2623_low_4
Description: NF2623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2623_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 42379865 - 42380229
Alignment:
| Q |
1 |
ctgggtacgttttctcatcgctcaaattcctgcagagggtatttaaatcaatgttctcttattctcatannnnnnnccctttataataataattagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42379865 |
ctgggtacgttttctcatcgctcaaattcctgtagagggtatttaaatcaatgttctcttattctcatatttttttccctttataataataattagatga |
42379964 |
T |
 |
| Q |
101 |
tttatcaagaggagcaaaggttgccnnnnnnnnnnnnnnnnnnnnnctttgttgacttgatttcaaatgcttataattctttatact-----ttatatct |
195 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42379965 |
tttatcaagaggagcaaaggttgcctttatttattatttttt----ctttgttgacttgatttcaaatgcttataattctttatactgtactttatatct |
42380060 |
T |
 |
| Q |
196 |
gaatgtggtttaaataaactgtttctgaacagtgatacttaattttgacttttctactgtctctgcactcttgactttcacaattgtgcattatctgtct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42380061 |
gaatgtggtttaaataaactgtttctgaatagtgatacttaattttgacttttctactgtctctgcactcttgactttcacaattgtgcattatctgtct |
42380160 |
T |
 |
| Q |
296 |
gtaacattttctatttcagtttatccggttggaacagagttatttgctcttatagacatgatatatgat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42380161 |
gtaacattttctatttcagtttatccggttggaacagagttatttgctcttatagacatgatatatgat |
42380229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University