View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2624-Insertion-7 (Length: 182)
Name: NF2624-Insertion-7
Description: NF2624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2624-Insertion-7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 5 - 182
Target Start/End: Original strand, 31828889 - 31829066
Alignment:
| Q |
5 |
acaaatatgaggtaaagcatttagaactactaaaccataaagtttgcacatcaaaaactatttaagtaaactaaactacaatgtttctgatgtattcaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828889 |
acaaatatgaggtaaagcatttagaactactaaaccataaagtttgcacatcaaaaactatttaagtaaactaaactacaatgtttctgatgtattcaat |
31828988 |
T |
|
| Q |
105 |
tgcaaagatcattctaattggattaatatttgcggtgataatccagtcctaggctgcaaaagagtatgcaccggtaag |
182 |
Q |
| |
|
|||| |||||| | |||||| | ||||||||| | |||||||| || || | |||||||||||||||||||||||| |
|
|
| T |
31828989 |
tgcagggatcatatttattggactcatatttgcgctcataatccaatcatatgttgcaaaagagtatgcaccggtaag |
31829066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University