View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2624R-Insertion-2 (Length: 69)
Name: NF2624R-Insertion-2
Description: NF2624R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2624R-Insertion-2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 2951870 - 2951810
Alignment:
| Q |
9 |
gtaacgacgtccaatctaacaatatcaatatttgtcagttgagccagactttatgaactac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2951870 |
gtaacgacgtccaatctaacaatatcaatatttatcagttgagccagactttatgaactac |
2951810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University