View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2624_high_8 (Length: 230)
Name: NF2624_high_8
Description: NF2624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2624_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 3371393 - 3371194
Alignment:
| Q |
14 |
agagaagaaggcttattggaattaccatgtcaagctcaagcaaacgatagagtagttccaggaaaagcagataacctctgaaagagaagggttggttcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3371393 |
agagaagaaggcttattggaattaccatgtcaagctcaagcaaacgatagaatagttccaggaaaagcagataacctctgaaagagaagggttggttcaa |
3371294 |
T |
|
| Q |
114 |
agttgttgtctacgacacgcttcaatttgagacagagctagggttcaaaaggggaaaattgaagttgtagcacgatcattactgtgtcaatataagactt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
3371293 |
agttgttgtctacgacacgcttcaatttgagacagagctagggttcaaaaggggaaaattgaagttgttgcacgatcattcctgtgtcaatatacgactt |
3371194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University