View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2624_high_9 (Length: 228)
Name: NF2624_high_9
Description: NF2624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2624_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 564690 - 564917
Alignment:
| Q |
1 |
caataatggatttggaagcattggaaagtgaatctagtactggaatgattaaggtgatgtgaaacttgttaggatgaagattaaggagtttcttgatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
564690 |
caataatggatttggaagcattggaaagtgaatctagtactggaatgattaaggtgatgtgaaacttgttaggatgaagattaaggagtttcttgatgaa |
564789 |
T |
 |
| Q |
101 |
ctcagaaattgctatttgatgactcacaatggggactgaaaccacagcaatgtgtgtttttctttccatggaaatttgattagtttaggctctgatctgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
564790 |
ctcagaaattgctatttgatgactcacaatggggactgaaaccacagcaatgtgtgtttttctttccatggaaatttgattagtttaggctctgatccgt |
564889 |
T |
 |
| Q |
201 |
gttaatggaaggttgatttggttaatta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
564890 |
gttaatggaaggttgatttggttaatta |
564917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 874139 - 874194
Alignment:
| Q |
134 |
gactgaaaccacagcaatgtgtgtttttctttccatggaaatttgattagtttagg |
189 |
Q |
| |
|
|||| |||||| ||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
874139 |
gacttaaaccaaagcaatgaatgtttttctatccatggaaatttgattagtttagg |
874194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University