View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2624_low_11 (Length: 218)

Name: NF2624_low_11
Description: NF2624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2624_low_11
NF2624_low_11
[»] chr5 (1 HSPs)
chr5 (1-201)||(3544619-3544819)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 3544619 - 3544819
Alignment:
1 gcatcaagccaagggagtacagagccgtacaagactgcatagaaaacatgggtgacagtttggacagtcttagccaatcggttagggagttaggcagtat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3544619 gcatcaagccaagggagtacagagccgtacaagactgcatagaaaacatgggtgacagtttggacagtcttagccaatcggttagggagttaggcagtat 3544718  T
101 tggtcatgctgttggagaggactttgtgtggcacatgaccaacgtgcagacttgggtcagtgctgcacttactgatgataacacttgtcttgatggcttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3544719 tggtcatgctgttggagaggactttgtgtggcacatgaccaacgtgcagacttgggtcagtgctgcacttactgatgataacacttgtcttgatggcttt 3544818  T
201 g 201  Q
    |    
3544819 g 3544819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University