View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2625_high_10 (Length: 241)
Name: NF2625_high_10
Description: NF2625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2625_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 34771911 - 34771688
Alignment:
| Q |
19 |
aatgattcactagttctccttgaatcattgaatgaaaggcatacaagatttatgcaagtgatgagttgcaccataagctagctatttctaacatatatga |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771911 |
aatgattcattagttctccttgaatcattgaatgaaaggcatacaagatttatgcaagtgatgagttgcaccataagctagctatttctaacatatatga |
34771812 |
T |
 |
| Q |
119 |
tttcttaccatacaagtaagaaactaccttctctaactactttcatatgaaa-ccagaaac--atagaactgtcaaaaacagttggcattaactaatcaa |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34771811 |
tttcttaccatacaagtaagtaactaccttctctaactactttcatatgaaacccagaaacatatagaactgtcaaatacagttggcattaactaatcaa |
34771712 |
T |
 |
| Q |
216 |
ccaccatcaactagtttgaagtat |
239 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
34771711 |
ccaccataaactagtttgaagtat |
34771688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University