View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629-Insertion-8 (Length: 369)
Name: NF2629-Insertion-8
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629-Insertion-8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 358; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 4 - 369
Target Start/End: Complemental strand, 26735804 - 26735439
Alignment:
| Q |
4 |
aacatatcccaaaagcctcattatgtttctgtgtctaatccttcccaatgtctctatctcagctttgaatccataatcatttctaccacttccttgtcca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735804 |
aacatatcccaaaagcctcattatgtttctgtgtctaatccttcccaatgtctctatctcagctttgaatccataatcatttctaccacttccttgtcca |
26735705 |
T |
|
| Q |
104 |
actaaacgctttatcgcaacgtctgttccgtttgccatggaccctctgtagacaatcccagctcctccttttcctattatgttctcttctttcagacact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735704 |
actaaacgctttatcgcaacgtctgttccgtttgccatggaccctctgtagacaatcccagctcctccttttcctattatgttctcttctttcagacact |
26735605 |
T |
|
| Q |
204 |
ccactacttcctctgctctgaattccaacttctgaaacgctgttagcttccatgcttttgccatgtgacgcttcctcttcctcatcatgtgcagtgttac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735604 |
ccactacttcctctgctctgaattccaacttctgaaacgctgttagcttccatgcttttgccatgtgacgcttcctcttcctcatcatgtgcagtgttac |
26735505 |
T |
|
| Q |
304 |
aattaccattaacaccgctgtggcaaagacgattgttatgacgacagctttctcctttgcatggct |
369 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26735504 |
aattaccattaacaccgctgtggcgaagacgattgctatgacgacagctttctcctttgcatggct |
26735439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 240 - 369
Target Start/End: Complemental strand, 26727254 - 26727125
Alignment:
| Q |
240 |
acgctgttagcttccatgcttttgccatgtgacgcttcctcttcctcatcatgtgcagtgttacaattaccattaacaccgctgtggcaaagacgattgt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||| || ||| ||||||||||||| |||| |
|
|
| T |
26727254 |
acgctgttagcttccatgcttttgccatgtgacgcttcctcttccttatcatgtacaatgttacaattaccatcaaaaccactgtggcaaagacaattgc |
26727155 |
T |
|
| Q |
340 |
tatgacgacagctttctcctttgcatggct |
369 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
26727154 |
tatgacgatgactttctcctttgcatggct |
26727125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University