View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629_low_10 (Length: 321)
Name: NF2629_low_10
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 99 - 235
Target Start/End: Complemental strand, 30250849 - 30250714
Alignment:
| Q |
99 |
aaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatatttaaactgattcacaaaaaacannnnnnnnnnattc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||| |
|
|
| T |
30250849 |
aaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatatttaaactgattcagaaaaaata-tttttttttattc |
30250751 |
T |
|
| Q |
199 |
atagttaaccaaaaacagaaaaataaacgaaaatcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250750 |
atagttaaccaaaaacagaaaaataaacgaaaatcat |
30250714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 287 - 321
Target Start/End: Complemental strand, 30250663 - 30250629
Alignment:
| Q |
287 |
aaaagttactgggattgattatcataacttttaaa |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250663 |
aaaagttactgggattgattatcataacttttaaa |
30250629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University