View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629_low_12 (Length: 305)
Name: NF2629_low_12
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629_low_12 |
 | |
|
| [»] scaffold0964 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 67 - 261
Target Start/End: Complemental strand, 25678237 - 25678043
Alignment:
| Q |
67 |
tcaccgaagccctagattgtaagcagtttaaaaaattaagggctaaattggggattttcctgcacgaggagatataaaaatctgttgtgtaagacgtgct |
166 |
Q |
| |
|
||||| || |||||||| ||||| ||||| |||||||||| || ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25678237 |
tcaccaaatccctagatggtaagtagtttgaaaaattaagagccaaattggggattttcttgcatgaggagatataaaaatctgttgtgtaagacgtgct |
25678138 |
T |
|
| Q |
167 |
cttcttaattccttgttgcacgtctttgtgtgagggctaggccctagctatttttgagcaccaagtgtgcctatggtctgtaatcctatgatact |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25678137 |
tttcttaattccttgttgcatgtctttgtgtgagggctaagccctggctatttttgagcaccaagtgtgcctatggtctgtaatcctatggtact |
25678043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0964 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0964
Description:
Target: scaffold0964; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 219 - 254
Target Start/End: Complemental strand, 47 - 12
Alignment:
| Q |
219 |
tttgagcaccaagtgtgcctatggtctgtaatccta |
254 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47 |
tttgagcatcaagtgtgcctatggtctgtaatccta |
12 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University