View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629_low_17 (Length: 274)
Name: NF2629_low_17
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 52 - 246
Target Start/End: Original strand, 1875714 - 1875908
Alignment:
| Q |
52 |
ggttgttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtggagggtgtgtggcacttcttg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1875714 |
ggttgttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtggagggtgtgtggcacttcttg |
1875813 |
T |
 |
| Q |
152 |
gtgttgcaaaattggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcctttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1875814 |
gtgttgcaaaattggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcttttg |
1875908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 52 - 236
Target Start/End: Original strand, 1808110 - 1808294
Alignment:
| Q |
52 |
ggttgttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtggagggtgtgtggcacttcttg |
151 |
Q |
| |
|
|||| |||||||||||| ||||| |||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
1808110 |
ggttcttggtttggtgctgtgccaacttgtcatggtgctggaggactagcaggacagtataaatttggaggaaggagtggagggtgtgttgcacttcttg |
1808209 |
T |
 |
| Q |
152 |
gtgttgcaaaattggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgt |
236 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
1808210 |
gttttgcaaaattggtattgggattggttttaggaacttctttggcacacattttgcaacaatttccagttgggattttaggtgt |
1808294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 52 - 246
Target Start/End: Complemental strand, 25798102 - 25797908
Alignment:
| Q |
52 |
ggttgttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtggagggtgtgtggcacttcttg |
151 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||| |||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25798102 |
ggttgttggtttggttgtgtgccaacttgtcatggtgccggtggactcgcaggacaatataaatttggtggaagaagtggagggtgtgtggcacttcttg |
25798003 |
T |
 |
| Q |
152 |
gtgttgcaaaattggtattgggattggtgttaggaacttctttggcacacattttaatgcagtttccagttgggattttaggtgttttgcctttg |
246 |
Q |
| |
|
||| | |||||||||||| |||||| |||| |||||||| |||||| ||||||||| | |||||| || ||||| ||||| || |||| |||| |
|
|
| T |
25798002 |
gtgcaggaaaattggtattaggattgttgttgggaacttccttggcaaacattttaaagatgtttccggtcgggatcttaggagtgttgcttttg |
25797908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 56 - 173
Target Start/End: Complemental strand, 49993255 - 49993138
Alignment:
| Q |
56 |
gttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtggagggtgtgtggcacttcttggtgt |
155 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
49993255 |
gttggtttggtgctatgccatgctgtcatggtgctggaggattagcaggacagtataaatttggtgggaggagtggagggtgtgtggcaattcttggtgc |
49993156 |
T |
 |
| Q |
156 |
tgcaaaattggtattggg |
173 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
49993155 |
tgcaaaattggttttggg |
49993138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 131
Target Start/End: Original strand, 2862179 - 2862258
Alignment:
| Q |
52 |
ggttgttggtttggtgcaatgccatcttgccatggtgctggtggactagcaggacagtataaatttggtggaaggagtgg |
131 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||| ||||||||| | || || ||||||| ||||| || |||||||| |
|
|
| T |
2862179 |
ggttgttggtttggtgctatgccttgttgccatggagctggtggattggctggtcagtataggtttggaggtaggagtgg |
2862258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University