View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629_low_30 (Length: 207)
Name: NF2629_low_30
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629_low_30 |
 |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 26517740 - 26517639
Alignment:
| Q |
1 |
gatgacagtgagaatgaagaaaacaaaggtggcttggagcattcttctagcgacttagattttgatgaaaaacgtagaaggtgatcgacttcttttgata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26517740 |
gatgacagtgagaatgaagaaaacaaaggtggcttggagcattcttctagcgacttagattctgatgaagaacgtagaaggtgatcgacttcttttgata |
26517641 |
T |
 |
| Q |
101 |
tt |
102 |
Q |
| |
|
|| |
|
|
| T |
26517640 |
tt |
26517639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 30374783 - 30374700
Alignment:
| Q |
1 |
gatgacagtgagaatgaagaaaacaaaggtggcttggagcattcttctagcgacttagattttgatgaaaaacgtagaaggtga |
84 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| ||||| |||||||||| ||| ||| |||||||||||||| |
|
|
| T |
30374783 |
gatgacagtgagaatgatgaaaacaaaggtggctcggagcattcatctagtgacttagattctgacgaagaacgtagaaggtga |
30374700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 13211 - 13255
Alignment:
| Q |
25 |
aaaggtggcttggagcattcttctagcgacttagattttgatgaa |
69 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
13211 |
aaaggtggctcggagcattcatctagtgacttatattttgatgaa |
13255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University