View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2629_low_6 (Length: 433)
Name: NF2629_low_6
Description: NF2629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2629_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 83 - 413
Target Start/End: Original strand, 28988029 - 28988356
Alignment:
| Q |
83 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacac |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28988029 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacac |
28988128 |
T |
|
| Q |
183 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtctaagttagaattttggagctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28988129 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtataagttagaattttggagctt |
28988228 |
T |
|
| Q |
283 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtacattgattatgttaatgatgcttccgggttctgatt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28988229 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtac---gattatgttaatgatgcttctgggttctgatt |
28988325 |
T |
|
| Q |
383 |
ttgagccctgttattttgtggctgatgatgt |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28988326 |
ttgagccctgttattttgtggctgatgatgt |
28988356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
| Q |
205 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University