View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2630_high_4 (Length: 309)
Name: NF2630_high_4
Description: NF2630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2630_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 1465160 - 1465433
Alignment:
| Q |
18 |
tttctttattttcttctagcatctttactannnnnnnngtcacaacaatacagaatgggacagtgatgttgacgaattcacgcatttaggataacgttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1465160 |
tttctttattttcttctagcatctttactattttttt-gtcacaacaatacagaatgggacagtgatgttgacgaattcacgcattaaggataacgttgt |
1465258 |
T |
 |
| Q |
118 |
tgaacagcagacatatttcaaaacattttttnnnnnnnnnnnnntgctgaacatgaaataaaaacggttcaatctcgacctaacaatctcgattatccta |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1465259 |
tgaacaacagacatatttcaaaacattttttaaaaaataaaaaatactgaacatgaaataaaaacggttcaatctcgacctaacaatctcgattatccta |
1465358 |
T |
 |
| Q |
218 |
aatacgtaaaaccacaatattccacatgcaaaggtttcaaaattgttcagaaatgcatgtaatatgttagcatctaatg |
296 |
Q |
| |
|
||| | |||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1465359 |
aatgcataaaaccacaatattccacatgcaaatttt----gtttggacagaaatgcatgtaatatgttagcatctaatg |
1465433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University