View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2630_high_5 (Length: 240)
Name: NF2630_high_5
Description: NF2630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2630_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 42248030 - 42248252
Alignment:
| Q |
19 |
atatacgtctaagaaatagtatatagttgactatacatgtgatagttctccctgtggtcgaaaatttaccagaaatgataatgcttctttttcatgcagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42248030 |
atatacgtctaagaaatagtatatagttgactatacatgtgatagttctccctgtggtcgaaaatttaccagaaatgataatgcttctttttcatgcaga |
42248129 |
T |
 |
| Q |
119 |
gctatgcaatatcatgggcctatagcttc-nnnnnnnntcataattaatgtgttgaaacatgttggctatatttccaaatcaatactgatggattaacaa |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42248130 |
gctatgcaacatcatgggcctatagcttcaaaaaaaaatcataattaatgtgttgaaacaagttggctatatttccaaatcaatactgatggattaacaa |
42248229 |
T |
 |
| Q |
218 |
atcgatgggttgtgaggacagct |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42248230 |
atcgatgggttgtgaggacagct |
42248252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University