View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2630_high_6 (Length: 229)
Name: NF2630_high_6
Description: NF2630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2630_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 35046530 - 35046338
Alignment:
| Q |
17 |
acatactccatctcttcagccatattggtgctcttcattgtcatgatgtaagttactatctttcttccctaatgctacgttgtatctataacatttatta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046530 |
acatactccatctcttctgccatattggtgctcttcattgtcatgatgtaagttactatctttcttccctaatgctacgttgtatctataacatttatta |
35046431 |
T |
|
| Q |
117 |
aatagttgctattaatatggttgctaggtcatatataaaatatgtagagtccaaacatttatttatatggttccccatgttgatttaagatcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046430 |
aatagttgctattaatatggttgctaggtcatatataaaatatgtagagtccaaacatttatttatatggttccccatgttgatttaagatcc |
35046338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University