View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2630_low_4 (Length: 389)
Name: NF2630_low_4
Description: NF2630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2630_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 186 - 379
Target Start/End: Complemental strand, 29583810 - 29583617
Alignment:
| Q |
186 |
gtgagaaatatcccttaccttacaaaccgatattgtgaggttgagttaggtccaaaccaaaatttaagataatattagagttcattcgtaatgacacttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583810 |
gtgagaaatatcccttaccttacaaaccgatattgtgaggttgagttaggtccaaaccaaaatttaagataatattagagttcattcgtaatgacacttg |
29583711 |
T |
|
| Q |
286 |
gattatgctccagattttccatccttggcatctctaggtttatagtgatactcactcaactcattcgcaaaaagggatgtacactcttcctatg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29583710 |
gattatgctccagattttccatccttggcatctctaggtttatagtgatactcactcaactcattcgcaaaaagggatgtacactctttctatg |
29583617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 20 - 177
Target Start/End: Complemental strand, 29584078 - 29583921
Alignment:
| Q |
20 |
tggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29584078 |
tggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaatatcacttgaacttagagcaagtagaactcactatacttgtgctccttgtg |
29583979 |
T |
|
| Q |
120 |
tggctgtaaggcatcataaccaacttatgaatttgctacgctgattaactacagcttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29583978 |
tggctgtaaggcatcataaccaacttctgaatttgctacgttgattaactacagcttt |
29583921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 29 - 132
Target Start/End: Original strand, 29610626 - 29610729
Alignment:
| Q |
29 |
tgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtgtggctgtaa |
128 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||| || ||| |||| |||||| |
|
|
| T |
29610626 |
tgtagagatgcagatttagttcaaaaaattgcagctgcaacgtcacttgaacttagagcaagtggaactcactatactttagcccctagtgtatctgtaa |
29610725 |
T |
|
| Q |
129 |
ggca |
132 |
Q |
| |
|
|||| |
|
|
| T |
29610726 |
ggca |
29610729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 133
Target Start/End: Complemental strand, 25128882 - 25128780
Alignment:
| Q |
31 |
tagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtgtggctgtaagg |
130 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| | |||||| ||| |||||| |||| |||||||| | |||||||||||| || |||||| |
|
|
| T |
25128882 |
tagagatgctgatttagttagaagaattggagctgcaacggcgcttgaagttaaagcaagcggaattcactataactttgctccttgtgtcgcggtaagg |
25128783 |
T |
|
| Q |
131 |
cat |
133 |
Q |
| |
|
||| |
|
|
| T |
25128782 |
cat |
25128780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 254
Target Start/End: Complemental strand, 19809995 - 19809943
Alignment:
| Q |
202 |
accttacaaaccgatattgtgaggttgagttaggtccaaaccaaaatttaaga |
254 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
19809995 |
accttacaagccgattttgtaaggttgagttaggcccaacccaaaatttaaga |
19809943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University