View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2630_low_8 (Length: 217)
Name: NF2630_low_8
Description: NF2630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2630_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 21 - 145
Target Start/End: Complemental strand, 7563490 - 7563366
Alignment:
| Q |
21 |
tttggaaccattccattttgaaccctaacaacatgttcccgatctccatagtaatttgagtgatgcccactagtgtaatagttgctattccctgcattat |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7563490 |
tttggacccattccattttgaaccctaacaacatgttcccgatctccatagtaatttgagtgatgcccactagtgtaatagttactattccctgcattat |
7563391 |
T |
|
| Q |
121 |
atattgaaatgttaacagtagaaga |
145 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7563390 |
atattgaaatgttaacagtagaaga |
7563366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 7563312 - 7563272
Alignment:
| Q |
159 |
ttgggtgtgtattataaattcaatggtaaaagtttgacttg |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7563312 |
ttgggtgtgtattataagttcaatggtaaaagtttgacttg |
7563272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University